Journal: Cancer prevention research (Philadelphia, Pa.)

Article Title: Mechanistic Contribution of Ubiquitous 15-Lipoxygenase-1 Expression Loss in Cancer Cells to Terminal Cell Differentiation Evasion

doi: 10.1158/1940-6207.CAPR-10-0280

Figure Lengend Snippet: Effects of 15-LOX-1 downregulation on terminal cell differentiation, tight junction formation, and E-cadherin membrane localization in colon cells. Caco-2 wild-type (WT) cells and clones of 15-LOX-1 shRNA stably transfected Caco-2 cells with either successful [15-LOX-1 KD (+)] or unsuccessful [15-LOX-1 KD (−)] 15-LOX-1 knockdown were treated with sodium butyrate (NaBT) for 48 hours and then harvested and processed for 15-LOX-1 expression by Western blotting (Fig. 5A) and alkaline phosphatase enzymatic activity as a marker of cell differentiation (Fig. 5B). Values are the means and standard errors of the means of triplicate measurements. * P < 0.0001 (two-way analysis of variance). Positive control in A is cell lysate protein extract from HCT-116 cells transfected with a 15-LOX-1 expression vector. C, 15-LOX-1 KD (+) and 15-LOX-1 KD (−) cells were cultured for 14 days after confluence. 15-LOX-1 mRNA levels were measured by quantitative real-time reverse transcription-polymerase chain reaction on days 0 and 14 after confluence. Values are the means and standard errors of the means of triplicate measurements. * P < 0.0001 (two-way analysis of variance). D, 15-LOX-1 KD (+) and 15-LOX-1 KD (−) cells were evaluated for tight junction formation using FITC-dextran fluorescence permeability assay on day 14 after confluence. Relative fluorescence intensity values (relative to that of wild-type Caco-2 cells) at various time points are shown. Values are the means and standard errors of the means of triplicate measurements of three experiments. * P < 0.008 (t-test). E, 15-LOX-1 KD (+) and 15-LOX-1 KD (−) cells were cultured for the indicated numbers of days after confluence. Equal protein amounts from cytoskeleton-associated (insoluble) and total cell lysates were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis separation followed by Western blotting. Band intensities (lower panel) for the blotted E-cadherin were quantified using an Odyssey fluorescent imager (LI-COR Biosciences, Lincoln, NE) and Odyssey software.

Article Snippet: We selected the pRS-15-LOX-1-shRNA-83 vector (OriGene) containing 29-base-pair shRNA forward sequence of 15-LOX-1: AGGCTTCTCTCCAGATGTCCATCACTTGG for the stable transfection experiments on the basis of preliminary studies showing efficient 15-LOX-1 gene downregulation.

Techniques: Cell Differentiation, Clone Assay, shRNA, Stable Transfection, Transfection, Expressing, Western Blot, Activity Assay, Marker, Positive Control, Plasmid Preparation, Cell Culture, Reverse Transcription Polymerase Chain Reaction, Fluorescence, Permeability, Polyacrylamide Gel Electrophoresis, Software

Journal: Cancer prevention research (Philadelphia, Pa.)

Article Title: Mechanistic Contribution of Ubiquitous 15-Lipoxygenase-1 Expression Loss in Cancer Cells to Terminal Cell Differentiation Evasion

doi: 10.1158/1940-6207.CAPR-10-0280

Figure Lengend Snippet: 15-LOX-1 and differentiation of primary NHBE cells. Primary NHBE cells were grown for 3 weeks in an undifferentiated state in immersion cultures or in air-liquid interface cultures to induce terminal differentiation into bronchial epithelial-like structures. Cells were then harvested and processed for quantitative real-time reverse transcription-polymerase chain reaction (panel A, differentiated vs. undifferentiated NHBE cells, P = 0.0005), Western blotting (panel B), and 13-HODE levels by liquid chromatography tandem mass spectroscopy (panel C, differentiated vs. undifferentiated NHBE cells, P = 0.0002). + represents 15-LOX-1 positive control (HCT-116 colon cancer cells transfected with 15-LOX-1 expression vector).

Article Snippet: We selected the pRS-15-LOX-1-shRNA-83 vector (OriGene) containing 29-base-pair shRNA forward sequence of 15-LOX-1: AGGCTTCTCTCCAGATGTCCATCACTTGG for the stable transfection experiments on the basis of preliminary studies showing efficient 15-LOX-1 gene downregulation.

Techniques: Reverse Transcription Polymerase Chain Reaction, Western Blot, Liquid Chromatography, Tandem Mass Spectroscopy, Positive Control, Transfection, Expressing, Plasmid Preparation

Journal: Cancer prevention research (Philadelphia, Pa.)

Article Title: Mechanistic Contribution of Ubiquitous 15-Lipoxygenase-1 Expression Loss in Cancer Cells to Terminal Cell Differentiation Evasion

doi: 10.1158/1940-6207.CAPR-10-0280

Figure Lengend Snippet: 15-LOX-1 and P16 mRNA and protein expression levels in cancer cell lines. A and B, A total of 128 cancer cell lines (Supplementary Table S1) were cultured and processed for 15-LOX-1 (panel A) and p16 (panel B) mRNA by quantitative real-time reverse transcription-polymerase chain reaction. Dots in the dot plots are means of triplicate measurements from each cell line. The relative expression levels were calculated relative to expression of the calibrator sample (differentiated NHBE cells). Solid lines represent the median value for each group. C, 15-LOX-1 relative expression levels in cancer cell lines compared to the level in Caco-2 cells terminally differentiated by sodium butyrate treatment. 15-LOX-1 mRNA measurements are as in panel A but with terminally differentiated Caco-2 cells as the calibrator sample. Dots in the dot plots are means of triplicate measurements from each cell line. The solid line represents the median value for the relative expression levels. D, 15-LOX-1 protein expression in cancer cell lines. Cell lines—including cell lines with 15-LOX-1 mRNA expression levels nearly equal to or greater than the level in differentiated Caco-2 cells or NHEK—were cultured, processed for Western blotting, and probed with 15-LOX-1 antibody. Three repeated experiments yielded similar results.

Article Snippet: We selected the pRS-15-LOX-1-shRNA-83 vector (OriGene) containing 29-base-pair shRNA forward sequence of 15-LOX-1: AGGCTTCTCTCCAGATGTCCATCACTTGG for the stable transfection experiments on the basis of preliminary studies showing efficient 15-LOX-1 gene downregulation.

Techniques: Expressing, Cell Culture, Reverse Transcription Polymerase Chain Reaction, Western Blot

Journal: Cancer prevention research (Philadelphia, Pa.)

Article Title: Mechanistic Contribution of Ubiquitous 15-Lipoxygenase-1 Expression Loss in Cancer Cells to Terminal Cell Differentiation Evasion

doi: 10.1158/1940-6207.CAPR-10-0280

Figure Lengend Snippet: 15-LOX-1 expression in normal and cancerous lung cells. A, Non-tumorigenic immortalized normal human bronchial epithelial cells (HBEC) (HBEC3KT, HBEC6KT, HBEC12KT, and HBEC24KT) and H460 lung cancer cells were grown in air-liquid interface cultures that were paraffin embedded, sectioned, and examined with hematoxylin-eosin (H&E) staining and 15-LOX-1 immunohistochemistry staining (IHC). B, Paired normal and non-small cell lung cancer tissues were immunohistochemically stained for expression of 15-LOX-1. Values are the intensity scores for 15-LOX-1 immunohistochemistry cytoplasmic staining (IHC intensity scores) in each individual case as listed in the table. NA: tissue samples were not available.

Article Snippet: We selected the pRS-15-LOX-1-shRNA-83 vector (OriGene) containing 29-base-pair shRNA forward sequence of 15-LOX-1: AGGCTTCTCTCCAGATGTCCATCACTTGG for the stable transfection experiments on the basis of preliminary studies showing efficient 15-LOX-1 gene downregulation.

Techniques: Expressing, Staining, Immunohistochemistry

Journal: Cancer prevention research (Philadelphia, Pa.)

Article Title: Mechanistic Contribution of Ubiquitous 15-Lipoxygenase-1 Expression Loss in Cancer Cells to Terminal Cell Differentiation Evasion

doi: 10.1158/1940-6207.CAPR-10-0280

Figure Lengend Snippet: Effects of 15-LOX-1 expression on Caco-2 cell spontaneous enterocyte differentiation. A and B, Effects of 15-LOX-1 shRNA on induced 15-LOX-1 expression during Caco-2 cell spontaneous enterocyte differentiation. Caco-2 cells were stably transfected with either non-targeted shRNA (control shRNA) or 15-LOX-1 shRNA and cultured for 14 days after confluence. Cells were collected at the time of confluence (0) and 14 days after confluence. 15-LOX-1 mRNA levels were measured by quantitative real-time reverse transcription-polymerase chain reaction (A) and Western blotting (B). The relative expression levels in A were calculated relative to the expression level of the calibrator sample (control shRNA, day 0). Values shown are the means ± standard deviations of triplicate measurements. * P < 0.0001. Positive control in B is cell lysate protein extract from HCT-116 cells transfected with a 15-LOX-1 expression vector. C, Effects of 15-LOX-1 on the morphology of Caco-2 cells. Caco-2 cells were cultured as described for panel A for 14 days after confluence and then fixed and examined by transmission electron microscopy. Magnifications are as indicated for each of the images. D and E, Effects of 15-LOX-1 downregulation on cell-cell contact and tight junction assembly. Caco-2 cells transfected with 15-LOX-1 shRNA or control vector were cultured to induce terminal differentiation for 14 days after confluence. Cells were processed for immunofluorescence using either ZO-1 or E-cadherin antibodies. Representative confocal microscope-captured images for staining with ZO-1 (D) and E-cadherin (E) are shown. The images for ZO-1 in the right column represent enlarged sections of the images in the left column. These enlargements demonstrate the differences in the plasma membrane structure of the cells. Bar, 10 µm.

Article Snippet: We selected the pRS-15-LOX-1-shRNA-83 vector (OriGene) containing 29-base-pair shRNA forward sequence of 15-LOX-1: AGGCTTCTCTCCAGATGTCCATCACTTGG for the stable transfection experiments on the basis of preliminary studies showing efficient 15-LOX-1 gene downregulation.

Techniques: Expressing, shRNA, Stable Transfection, Transfection, Cell Culture, Reverse Transcription Polymerase Chain Reaction, Western Blot, Positive Control, Plasmid Preparation, Transmission Assay, Electron Microscopy, Immunofluorescence, Microscopy, Staining